amyC [2019-05-30 19:15:22]

ABC transporter for melibiose and raffinose (permease)

Locus: BSU30290

Isoelectric point: 9.85

Molecular weight: 30.22 kDa

Protein length: 276 aa

Gene length: 831 bp

Function: uptake of melibiose and raffinose

Product: sugar ABC transporter

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of melibiose
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,100,031 3,100,861

The protein

Structure

• 4TQU (from Sphingomonas sp., 26% identity) PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: melR-melE-melD-melC-melA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, PubMed, in CcpA regulon
  • MelR: repression, PubMed, in MelR regulon

  Regulation

  • induced by melibiose or raffinose (MelR) PubMed
  • repressed by glucose (CcpA) PubMed
  • there is an additional RNA "upshift" signal in front of the melE gene suggestive of a melE-melD-melC-melA mRNA PubMed. However, there is no promoter in front of melE, suggesting that this mRNA may be the product of mRNA processing PubMed

Biological materials

Mutant

• MGNA-A798 (amyC::erm), available at the NBRP B. subtilis, Japan
• BKE30290 (melC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCTTTTTGTACGGGCGG, downstream forward: _UP4_GGTTAACATTAAAGGGGGAA
• BKK30290 (melC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCTTTTTGTACGGGCGG, downstream forward: _UP4_GGTTAACATTAAAGGGGGAA

References

Loading